Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AAACAGGTCCCGGGGTGCACTGCCA[C/T]TGATAGCAGGATTGGGGGGCCCAGC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
11 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 116900 MIM: 606903 MIM: 600560 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CKS1B PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CKS1B - CDC28 protein kinase regulatory subunit 1B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC101928120 - uncharacterized LOC101928120 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR4258 - microRNA 4258 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PBXIP1 - PBX homeobox interacting protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PYGO2 - pygopus family PHD finger 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SHC1 - SHC adaptor protein 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001130040.1 | 1102 | Intron | NP_001123512.1 | |||
NM_001130041.1 | 1102 | Intron | NP_001123513.1 | |||
NM_001202859.1 | 1102 | Intron | NP_001189788.1 | |||
NM_003029.4 | 1102 | Intron | NP_003020.2 | |||
NM_183001.4 | 1102 | Intron | NP_892113.4 | |||
XM_005245449.4 | 1102 | Missense Mutation | AAT,AGT | N,S 451 | XP_005245506.1 | |
XM_005245451.4 | 1102 | Missense Mutation | AAT,AGT | N,S 341 | XP_005245508.1 | |
XM_011509892.2 | 1102 | Missense Mutation | AAT,AGT | N,S 461 | XP_011508194.1 | |
XM_011509893.2 | 1102 | Missense Mutation | AAT,AGT | N,S 460 | XP_011508195.1 | |
XM_011509894.2 | 1102 | Missense Mutation | AAT,AGT | N,S 443 | XP_011508196.1 | |
XM_011509897.1 | 1102 | Intron | XP_011508199.1 | |||
XM_011509898.2 | 1102 | Missense Mutation | AAT,AGT | N,S 285 | XP_011508200.1 | |
XM_017002081.1 | 1102 | Missense Mutation | AAT,AGT | N,S 434 | XP_016857570.1 | |
XM_017002082.1 | 1102 | Missense Mutation | AAT,AGT | N,S 433 | XP_016857571.1 | |
XM_017002083.1 | 1102 | Intron | XP_016857572.1 |