Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACACAAGAGAAAACTTGACTCACAG[A/G]CGTAAAAGGGTTTAGGTCCTTGTTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
2 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 600172 MIM: 612276 | ||||||||||||||||||||
Literature Links: |
C1orf122 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C1orf122 - chromosome 1 open reading frame 122 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001142726.1 | 515 | Intron | NP_001136198.1 | |||
NM_198446.2 | 515 | Intron | NP_940848.2 |
MANEAL - mannosidase endo-alpha like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MTF1 - metal regulatory transcription factor 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
YRDC - yrdC N6-threonylcarbamoyltransferase domain containing | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_024640.3 | 515 | Missense Mutation | CCT,TCT | P,S 168 | NP_078916.3 |