Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTGGTCGGGGCCCCCGCTGCTGCCC[A/G]GCCGGCTGCTGGCCGGGCTCCTGCT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
4 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 611901 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ANKRD65 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ANKRD65 - ankyrin repeat domain 65 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC102724312 - uncharacterized LOC102724312 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC107985729 - uncharacterized LOC107985729 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMEM88B - transmembrane protein 88B | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001146685.1 | 145 | Missense Mutation | AGC,GGC | S,G 49 | NP_001140157.1 |
VWA1 - von Willebrand factor A domain containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |