Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGAGTGGCAGACAGCAATGAGGCCA[C/T]ATCCCTGGAGCTGCCCGGGGGAAGT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
5 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 603618 MIM: 611813 MIM: 159530 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CDC20 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CDC20 - cell division cycle 20 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001255.2 | 1030 | Intron | NP_001246.2 |
ELOVL1 - ELOVL fatty acid elongase 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001256399.1 | 1030 | UTR 3 | NP_001243328.1 | |||
NM_001256401.1 | 1030 | UTR 3 | NP_001243330.1 | |||
NM_001256402.1 | 1030 | UTR 3 | NP_001243331.1 | |||
NM_022821.3 | 1030 | UTR 3 | NP_073732.1 |
MIR6734 - microRNA 6734 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MPL - MPL proto-oncogene, thrombopoietin receptor | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |