Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACAGCTGAAAGGCTGGGCCGAGGTT[A/G]TATGTGGGATGTGACTGGAGAAGAT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
13 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 611275 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
BNIPL PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
BNIPL - BCL2 interacting protein like | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001159642.1 | 922 | Missense Mutation | TAT,TGT | Y,C 84 | NP_001153114.1 | |
NM_138278.3 | 922 | Missense Mutation | TAT,TGT | Y,C 166 | NP_612122.2 | |
XM_011509236.1 | 922 | Missense Mutation | TAT,TGT | Y,C 166 | XP_011507538.1 | |
XM_017000420.1 | 922 | UTR 5 | XP_016855909.1 |
C1orf56 - chromosome 1 open reading frame 56 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CDC42SE1 - CDC42 small effector 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PRUNE1 - prune exopolyphosphatase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |