Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACTGACTTACCAGACTTGTAGTTTG[A/G]TCTTCTTCCCCTCTATATCCACAGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
3 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 604671 MIM: 602672 MIM: 603702 | ||||||||||||||||||||
Literature Links: |
JTB PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
JTB - jumping translocation breakpoint | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NUP210L - nucleoporin 210 like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RAB13 - RAB13, member RAS oncogene family | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001272038.1 | 429 | UTR 5 | NP_001258967.1 | |||
NM_002870.3 | 429 | Missense Mutation | ACC,ATC | T,I 57 | NP_002861.1 | |
XM_017001959.1 | 429 | Intron | XP_016857448.1 |
RPS27 - ribosomal protein S27 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |