Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTCCAGAGGGGTATCAGCTGCCTCA[C/G]AACAGGCGCATGACCCATTTAGCAC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
10 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 601655 | ||||||||||||||||||||
Literature Links: |
EYA3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
EYA3 - EYA transcriptional coactivator and phosphatase 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SMPDL3B - sphingomyelin phosphodiesterase acid like 3B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
XKR8 - XK related 8 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_018053.3 | 1718 | Missense Mutation | CAC,CAG | H,Q 370 | NP_060523.2 | |
XM_011541679.2 | 1718 | Missense Mutation | CAC,CAG | H,Q 424 | XP_011539981.1 | |
XM_011541680.2 | 1718 | Missense Mutation | CAC,CAG | H,Q 388 | XP_011539982.1 |