Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTCAGTGAAGTCATGGCAAGTAGCA[C/T]AGCCACCCATGTCAGAGGTTCGAAC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604526 MIM: 614155 MIM: 614154 | ||||||||||||||||||||
Literature Links: |
IDH3B PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
IDH3B - isocitrate dehydrogenase 3 (NAD(+)) beta | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001258384.2 | 1132 | Intron | NP_001245313.1 | |||
NM_006899.4 | 1132 | UTR 3 | NP_008830.2 | |||
NM_174855.3 | 1132 | Missense Mutation | TAT,TGT | Y,C 366 | NP_777280.1 | |
XM_005260716.1 | 1132 | UTR 3 | XP_005260773.1 |
MIR1292 - microRNA 1292 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NOP56 - NOP56 ribonucleoprotein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006392.3 | 1132 | Intron | NP_006383.2 |
SNORA51 - small nucleolar RNA, H/ACA box 51 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD110 - small nucleolar RNA, C/D box 110 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD56 - small nucleolar RNA, C/D box 56 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD57 - small nucleolar RNA, C/D box 57 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD86 - small nucleolar RNA, C/D box 86 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |