Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTAAGAATGCCTAAGATCCTTCTTC[A/G]TCCTCGATCTTGGGAGCCAAGTAGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 176740 MIM: 617019 | ||||||||||||||||||||
Literature Links: |
PCNA PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
PCNA - proliferating cell nuclear antigen | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_002592.2 | 1010 | Silent Mutation | NP_002583.1 | |||
NM_182649.1 | 1010 | Intron | NP_872590.1 |
PCNA-AS1 - PCNA antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMEM230 - transmembrane protein 230 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |