Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GACTTTTGACGTGTTCACATCAGAA[A/G]GAAAATTATTGCGTGGTGGATGGGT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 601218 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ADARB1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ADARB1 - adenosine deaminase, RNA specific B1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001112.3 | Intron | NP_001103.1 | ||||
NM_001160230.1 | Intron | NP_001153702.1 | ||||
NM_015833.3 | Intron | NP_056648.1 | ||||
NM_015834.3 | Intron | NP_056649.1 | ||||
XM_006723954.2 | Intron | XP_006724017.1 | ||||
XM_011529425.2 | Intron | XP_011527727.1 | ||||
XM_011529432.1 | Intron | XP_011527734.1 | ||||
XM_017028242.1 | Intron | XP_016883731.1 | ||||
XM_017028243.1 | Intron | XP_016883732.1 | ||||
XM_017028244.1 | Intron | XP_016883733.1 | ||||
XM_017028245.1 | Intron | XP_016883734.1 | ||||
XM_017028246.1 | Intron | XP_016883735.1 | ||||
XM_017028247.1 | Intron | XP_016883736.1 | ||||
XM_017028248.1 | Intron | XP_016883737.1 | ||||
XM_017028249.1 | Intron | XP_016883738.1 | ||||
XM_017028250.1 | Intron | XP_016883739.1 | ||||
XM_017028251.1 | Intron | XP_016883740.1 | ||||
XM_017028252.1 | Intron | XP_016883741.1 | ||||
XM_017028253.1 | Intron | XP_016883742.1 | ||||
XM_017028254.1 | Intron | XP_016883743.1 | ||||
XM_017028255.1 | Intron | XP_016883744.1 | ||||
XM_017028256.1 | Intron | XP_016883745.1 |
LOC105372836 - uncharacterized LOC105372836 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SSR4P1 - signal sequence receptor subunit 4 pseudogene 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |