Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTCAACGTCGTCAAAGGAGTCATCA[C/T]ACTTCTGGACCTGGGGCTCATCTTC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 608544 MIM: 602898 MIM: 602399 | ||||||||||||||||||||
Literature Links: |
HDAC10 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
HDAC10 - histone deacetylase 10 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MAPK11 - mitogen-activated protein kinase 11 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MAPK12 - mitogen-activated protein kinase 12 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001303252.1 | 1197 | Missense Mutation | TAT,TGT | Y,C 316 | NP_001290181.1 | |
NM_002969.4 | 1197 | Missense Mutation | TAT,TGT | Y,C 326 | NP_002960.2 |