Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTCAGCATGAGGCAGATGTTGAGGA[C/T]GATGCTCAGGGCTGGAATCAGGGGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 608077 MIM: 603752 | ||||||||||||||||||||
Literature Links: |
MIR649 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MIR649 - microRNA 649 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
P2RX6 - purinergic receptor P2X 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLC7A4 - solute carrier family 7 member 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_004173.2 | 1728 | Missense Mutation | ATC,GTC | I,V 554 | NP_004164.2 |