Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGCAGGCGCGGGCCGCTCATTTCGC[C/T]CTTTCCGGCGGTGCTCGCAAGCGAG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 613383 MIM: 613556 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ANKRD54 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ANKRD54 - ankyrin repeat domain 54 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_138797.2 | 47 | Intron | NP_620152.1 | |||
XM_006724136.1 | 47 | Intron | XP_006724199.1 | |||
XM_006724137.1 | 47 | Intron | XP_006724200.1 | |||
XM_011529877.2 | 47 | Intron | XP_011528179.1 | |||
XM_011529878.2 | 47 | Intron | XP_011528180.1 | |||
XM_011529879.2 | 47 | Intron | XP_011528181.1 | |||
XM_011529880.2 | 47 | Intron | XP_011528182.1 | |||
XM_011529882.2 | 47 | Intron | XP_011528184.1 | |||
XM_011529883.2 | 47 | Intron | XP_011528185.1 | |||
XM_011529884.2 | 47 | Intron | XP_011528186.1 | |||
XM_017028590.1 | 47 | Intron | XP_016884079.1 | |||
XM_017028591.1 | 47 | Intron | XP_016884080.1 | |||
XM_017028593.1 | 47 | Intron | XP_016884082.1 |
EIF3L - eukaryotic translation initiation factor 3 subunit L | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001242923.1 | 47 | UTR 5 | NP_001229852.1 | |||
NM_016091.3 | 47 | UTR 5 | NP_057175.1 | |||
XM_005261625.1 | 47 | Intron | XP_005261682.1 | |||
XM_006724260.3 | 47 | Missense Mutation | CCC,CTC | P,L 33 | XP_006724323.1 | |
XM_017028814.1 | 47 | Intron | XP_016884303.1 |
MIR658 - microRNA 658 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR659 - microRNA 659 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |