Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGGAACATGACATTTTTGTTCCAGA[C/G]GATGATGATGATGATGACTAACAGG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 614240 MIM: 602138 MIM: 615588 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
FAM109B PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
FAM109B - family with sequence similarity 109 member B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NDUFA6 - NADH:ubiquinone oxidoreductase subunit A6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NDUFA6-AS1 - NDUFA6 antisense RNA 1 (head to head) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SMDT1 - single-pass membrane protein with aspartate rich tail 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_033318.4 | 385 | Missense Mutation | GAC,GAG | D,E 101 | NP_201575.3 | |
XM_011530509.2 | 385 | Missense Mutation | GAC,GAG | D,E 101 | XP_011528811.1 |
SNORD13P1 - small nucleolar RNA, C/D box 13 pseudogene 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |