Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAGGCTGGATCTCCAGAACTGTTCT[C/T]TGGAGGACCCTGGTCCAAACTTTCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 114010 MIM: 604024 | ||||||||||||||||||||
Literature Links: |
ATRAID PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ATRAID - all-trans retinoic acid induced differentiation factor | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001170795.1 | 582 | Silent Mutation | CTG,TTG | L,L 82 | NP_001164266.1 | |
NM_016085.4 | 582 | Silent Mutation | CTG,TTG | L,L 24 | NP_057169.2 | |
NM_080592.3 | 582 | Silent Mutation | CTG,TTG | L,L 137 | NP_542159.3 |
CAD - carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLC5A6 - solute carrier family 5 member 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |