Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGGAGCGGTACCTTTCTCGGAGCTC[A/G]GCTCTCCCAGTGTGGGTGGAGCCGC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 602919 MIM: 607163 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
DOK1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
DOK1 - docking protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOXL3 - lysyl oxidase like 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
M1AP - meiosis 1 associated protein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001281295.1 | 694 | Intron | NP_001268224.1 | |||
NM_001281296.1 | 694 | Silent Mutation | NP_001268225.1 | |||
NM_001321739.1 | 694 | Silent Mutation | NP_001308668.1 | |||
NM_138804.4 | 694 | Silent Mutation | NP_620159.2 | |||
XM_005264152.3 | 694 | Nonsense Mutation | XP_005264209.1 | |||
XM_006711946.3 | 694 | Nonsense Mutation | XP_006712009.1 | |||
XM_011532548.2 | 694 | Nonsense Mutation | XP_011530850.1 | |||
XM_011532549.2 | 694 | Nonsense Mutation | XP_011530851.1 | |||
XM_011532550.2 | 694 | Nonsense Mutation | XP_011530852.1 | |||
XM_011532551.2 | 694 | Nonsense Mutation | XP_011530853.1 | |||
XM_011532552.2 | 694 | Nonsense Mutation | XP_011530854.1 | |||
XM_011532553.2 | 694 | Nonsense Mutation | XP_011530855.1 | |||
XM_011532554.2 | 694 | Nonsense Mutation | XP_011530856.1 |