Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAGAAGAACATAGCTGTTGAAACTG[A/T]TGTAAGAGTAAACAAAGACAGTCTT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 606237 | ||||||||||||||||||||
Literature Links: |
C2orf49 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C2orf49 - chromosome 2 open reading frame 49 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001286537.1 | 453 | Missense Mutation | GAT,GTT | D,V 41 | NP_001273466.1 | |
NM_024093.2 | 453 | Missense Mutation | GAT,GTT | D,V 41 | NP_076998.1 | |
XM_017004892.1 | 453 | Missense Mutation | GAT,GTT | D,V 79 | XP_016860381.1 |
LOC100506473 - uncharacterized LOC100506473 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TGFBRAP1 - transforming growth factor beta receptor associated protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |