Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AACTAAACAGTAAATGGAATATTCT[C/G]TGTGAAAAAATTAAGGGAATAATGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 610284 MIM: 607166 | ||||||||||||||||||||
Literature Links: |
LIPT1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LIPT1 - lipoyltransferase 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001204830.1 | 1193 | Silent Mutation | CTC,CTG | L,L 365 | NP_001191759.1 | |
NM_015929.3 | 1193 | Silent Mutation | CTC,CTG | L,L 365 | NP_057013.1 | |
NM_145197.2 | 1193 | Silent Mutation | CTC,CTG | L,L 365 | NP_660198.1 | |
NM_145198.2 | 1193 | Silent Mutation | CTC,CTG | L,L 365 | NP_660199.1 | |
NM_145199.2 | 1193 | Silent Mutation | CTC,CTG | L,L 365 | NP_660200.1 |
MITD1 - microtubule interacting and trafficking domain containing 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001320417.1 | 1193 | Intron | NP_001307346.1 | |||
NM_001320418.1 | 1193 | Intron | NP_001307347.1 | |||
NM_001320419.1 | 1193 | Intron | NP_001307348.1 | |||
NM_138798.2 | 1193 | Intron | NP_620153.1 | |||
XM_011510581.2 | 1193 | Intron | XP_011508883.1 | |||
XM_011510582.2 | 1193 | Intron | XP_011508884.1 | |||
XM_011510583.1 | 1193 | Intron | XP_011508885.1 | |||
XM_017003314.1 | 1193 | Intron | XP_016858803.1 | |||
XM_017003315.1 | 1193 | Intron | XP_016858804.1 |
TSGA10 - testis specific 10 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |