Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGAATCCCGCGGGAACAGCAAAAGG[C/T]AGCGTTGCAGGAGCTGACGCGGGCG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 602000 MIM: 608291 | ||||||||||||||||||||
Literature Links: |
LOC105373562 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LOC105373562 - uncharacterized LOC105373562 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
POLR1B - RNA polymerase I subunit B | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001137604.2 | 328 | Missense Mutation | GCA,GTA | A,V 33 | NP_001131076.1 | |
NM_001282772.1 | 328 | Missense Mutation | GCA,GTA | A,V 71 | NP_001269701.1 | |
NM_001282774.1 | 328 | Missense Mutation | GCA,GTA | A,V 33 | NP_001269703.1 | |
NM_001282776.1 | 328 | UTR 5 | NP_001269705.1 | |||
NM_001282777.1 | 328 | UTR 5 | NP_001269706.1 | |||
NM_001282779.1 | 328 | UTR 5 | NP_001269708.1 | |||
NM_019014.5 | 328 | Missense Mutation | GCA,GTA | A,V 33 | NP_061887.2 |
TTL - tubulin tyrosine ligase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |