Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAGAGGTCCGGGCAGCGTGTTACAA[C/T]GTGGGACTGTGACCAGGGCAAGCAC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 611622 | ||||||||||||||||||||
Literature Links: |
IQCJ PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
IQCJ - IQ motif containing J | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
IQCJ-SCHIP1 - IQCJ-SCHIP1 readthrough | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001197113.1 | 603 | Intron | NP_001184042.1 | |||
NM_001197114.1 | 603 | Intron | NP_001184043.1 |
MIR3919 - microRNA 3919 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SCHIP1 - schwannomin interacting protein 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001197107.1 | 603 | Missense Mutation | ACG,ATG | T,M 10 | NP_001184036.1 | |
NM_001197108.1 | 603 | Missense Mutation | ACG,ATG | T,M 10 | NP_001184037.1 | |
NM_001197109.1 | 603 | Intron | NP_001184038.1 | |||
NM_014575.3 | 603 | Missense Mutation | ACG,ATG | T,M 10 | NP_055390.1 |