Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAGATCGAATTCCTCAGCTACTGCC[A/T]GCTGCACGCGGCCATTGAGGCCCCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 615691 MIM: 615320 MIM: 606991 MIM: 614472 | ||||||||||||||||||||
Literature Links: |
AMIGO3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
AMIGO3 - adhesion molecule with Ig like domain 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_198722.2 | 1749 | Missense Mutation | CAG,CTG | Q,L 470 | NP_942015.1 |
GMPPB - GDP-mannose pyrophosphorylase B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
IP6K1 - inositol hexakisphosphate kinase 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RNF123 - ring finger protein 123 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_022064.4 | 1749 | Intron | NP_071347.2 | |||
XM_006713285.1 | 1749 | Intron | XP_006713348.1 | |||
XM_011533995.1 | 1749 | Intron | XP_011532297.1 | |||
XM_017007018.1 | 1749 | Intron | XP_016862507.1 |