Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAGTGGATCTGATGAACCGCACAAC[A/G]TCTGCCACACTCCACTTCAAGGGGT
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 607319 | |||||||||||||||||||||||
Literature Links: |
SFMBT1 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
SFMBT1 - Scm-like with four mbt domains 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_016329.3 | 3026 | Silent Mutation | GAC,GAT | D,D 800 | NP_057413.2 | |
XM_005265221.3 | 3026 | Silent Mutation | GAC,GAT | D,D 800 | XP_005265278.1 | |
XM_006713203.3 | 3026 | Silent Mutation | GAC,GAT | D,D 800 | XP_006713266.1 | |
XM_006713204.3 | 3026 | Silent Mutation | GAC,GAT | D,D 800 | XP_006713267.1 | |
XM_011533824.2 | 3026 | Silent Mutation | GAC,GAT | D,D 800 | XP_011532126.1 | |
XM_011533825.2 | 3026 | Silent Mutation | GAC,GAT | D,D 800 | XP_011532127.1 |
TMEM110 - transmembrane protein 110 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMEM110-MUSTN1 - TMEM110-MUSTN1 readthrough | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |