Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGGCTAGCGTGGTGGCGCTTCAGGG[A/C]TTCCAGGCGCCGGTGAAGCAGTTCG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 608790 MIM: 614855 | ||||||||||||||||||||
Literature Links: |
CCDC96 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CCDC96 - coiled-coil domain containing 96 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_153376.2 | 1642 | Missense Mutation | GCC,TCC | A,S 527 | NP_699207.1 |
LOC100129931 - uncharacterized LOC100129931 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TADA2B - transcriptional adaptor 2B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TBC1D14 - TBC1 domain family member 14 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |