Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAGGGCCGAAGGCTGGGTCCACCTC[G/T]CCCTCTGCCACTCCCTTGTAGAAGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 246530 MIM: 604561 MIM: 601530 | ||||||||||||||||||||
Literature Links: |
LTC4S PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LTC4S - leukotriene C4 synthase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MGAT4B - mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme B | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_014275.4 | 1734 | Silent Mutation | GGA,GGC | G,G 513 | NP_055090.1 | |
NM_054013.3 | 1734 | Silent Mutation | GGA,GGC | G,G 528 | NP_463459.1 | |
XM_017008998.1 | 1734 | Silent Mutation | GGA,GGC | G,G 513 | XP_016864487.1 |
MIR1229 - microRNA 1229 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SQSTM1 - sequestosome 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |