Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGATCATGTCATCCCCGCTCTCCAA[A/G]GAGCTGCGGCAGAAGTACAATGTCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||
Literature Links: |
ERGIC1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ERGIC1 - endoplasmic reticulum-golgi intermediate compartment 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC100268168 - uncharacterized LOC100268168 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RPL26L1 - ribosomal protein L26 like 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001317980.1 | 204 | Silent Mutation | AAA,AAG | K,K 36 | NP_001304909.1 | |
NM_001317981.1 | 204 | Silent Mutation | AAA,AAG | K,K 36 | NP_001304910.1 | |
NM_001317982.1 | 204 | Silent Mutation | AAA,AAG | K,K 36 | NP_001304911.1 | |
NM_016093.3 | 204 | Intron | NP_057177.1 | |||
XM_005265921.3 | 204 | Silent Mutation | AAA,AAG | K,K 65 | XP_005265978.1 | |
XM_011534565.2 | 204 | Silent Mutation | AAA,AAG | K,K 36 | XP_011532867.1 | |
XM_017009519.1 | 204 | Silent Mutation | AAA,AAG | K,K 36 | XP_016865008.1 | |
XM_017009520.1 | 204 | Intron | XP_016865009.1 |