Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGATGGAACAAGTGACGTCCACAGC[A/G]GAGATGTTTGTGACCCTTAGCAATG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 606000 | ||||||||||||||||||||
Literature Links: |
BTNL2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
BTNL2 - butyrophilin like 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001304561.1 | 3043 | Silent Mutation | TCC,TCT | S,S 429 | NP_001291490.1 | |
XM_017011057.1 | 3043 | Silent Mutation | TCC,TCT | S,S 429 | XP_016866546.1 |
HCG23 - HLA complex group 23 (non-protein coding) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC101929163 - uncharacterized LOC101929163 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |