Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCAAAGTTCTCACCGAACAAAATCT[C/G]TCAAAGCTGGGACCAAGGAACTTTG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 616953 MIM: 603763 MIM: 602881 MIM: 603384 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CUTA PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CUTA - cutA divalent cation tolerance homolog (E. coli) | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001014433.2 | 952 | Missense Mutation | ACA,AGA | T,R 153 | NP_001014433.1 | |
NM_001014837.1 | 952 | Missense Mutation | ACA,AGA | T,R 111 | NP_001014837.1 | |
NM_001014838.1 | 952 | Missense Mutation | ACA,AGA | T,R 111 | NP_001014838.1 | |
NM_001014840.1 | 952 | Missense Mutation | ACA,AGA | T,R 134 | NP_001014840.1 | |
NM_015921.2 | 952 | Missense Mutation | ACA,AGA | T,R 111 | NP_057005.1 |
KIFC1 - kinesin family member C1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PHF1 - PHD finger protein 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_002636.4 | 952 | Intron | NP_002627.1 | |||
NM_024165.2 | 952 | Intron | NP_077084.1 | |||
XM_011514662.1 | 952 | Intron | XP_011512964.1 | |||
XM_011514663.1 | 952 | Intron | XP_011512965.1 | |||
XM_011514664.1 | 952 | Intron | XP_011512966.1 | |||
XM_011514665.1 | 952 | Intron | XP_011512967.1 | |||
XM_011514666.1 | 952 | Intron | XP_011512968.1 | |||
XM_011514669.1 | 952 | Intron | XP_011512971.1 | |||
XM_011514670.2 | 952 | Intron | XP_011512972.1 | |||
XM_017010939.1 | 952 | Intron | XP_016866428.1 |
SYNGAP1 - synaptic Ras GTPase activating protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |