Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CATGCCAAGAAGCTGGGCCAGGACA[C/T]GCTCTCGGTTTCTCTGCTGGGAGCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 606853 MIM: 142560 MIM: 601022 | ||||||||||||||||||||
Literature Links: |
ATP6V1G2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ATP6V1G2 - ATPase H+ transporting V1 subunit G2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001204078.1 | 450 | Missense Mutation | CAT,CGT | H,R 54 | NP_001191007.1 | |
NM_130463.3 | 450 | Missense Mutation | CAT,CGT | H,R 94 | NP_569730.1 | |
NM_138282.2 | 450 | Missense Mutation | CAT,CGT | H,R 53 | NP_612139.1 |
ATP6V1G2-DDX39B - ATP6V1G2-DDX39B readthrough (NMD candidate) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
DDX39B - DEAD-box helicase 39B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
DDX39B-AS1 - DDX39B antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC100287329 - uncharacterized LOC100287329 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NFKBIL1 - NFKB inhibitor like 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD117 - small nucleolar RNA, C/D box 117 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD84 - small nucleolar RNA, C/D box 84 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |