Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAAAATCCTCTCGTTGTGCATAGTC[A/G]CTGCTTGATCGCTTGCCCTTCTGGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 605310 MIM: 164177 MIM: 600912 | ||||||||||||||||||||
Literature Links: |
CCHCR1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CCHCR1 - coiled-coil alpha-helical rod protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
POU5F1 - POU class 5 homeobox 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001173531.2 | 1588 | Silent Mutation | AGC,AGT | S,S 120 | NP_001167002.1 | |
NM_001285986.1 | 1588 | Silent Mutation | AGC,AGT | S,S 94 | NP_001272915.1 | |
NM_001285987.1 | 1588 | Silent Mutation | AGC,AGT | S,S 195 | NP_001272916.1 | |
NM_002701.5 | 1588 | Intron | NP_002692.2 | |||
NM_203289.5 | 1588 | Silent Mutation | AGC,AGT | S,S 120 | NP_976034.4 |
PSORS1C3 - psoriasis susceptibility 1 candidate 3 (non-protein coding) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TCF19 - transcription factor 19 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001077511.1 | 1588 | Intron | NP_001070979.1 | |||
NM_001318908.1 | 1588 | Intron | NP_001305837.1 | |||
NM_007109.2 | 1588 | Intron | NP_009040.2 |