Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TAACCTGTGCGCCATCCACGCCAAG[C/T]GCGTCACTATCATGCCCAAGGACAT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 142709 MIM: 602810 MIM: 602822 MIM: 602829 | ||||||||||||||||||||
Literature Links: |
HIST1H1A PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
HIST1H1A - histone cluster 1, H1a | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HIST1H3A - histone cluster 1, H3a | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_003529.2 | Intron | NP_003520.1 |
HIST1H4A - histone cluster 1, H4a | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_003538.3 | Intron | NP_003529.1 |
HIST1H4B - histone cluster 1, H4b | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |