Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCCACAATGGTCACGTCGCAGAACC[G/T]CTCCTCTGCCCGGAGCTGGTTCATG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 613927 MIM: 604599 | ||||||||||||||||||||
Literature Links: |
C2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C2 - complement component 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000063.5 | Intron | NP_000054.2 | ||||
NM_001145903.2 | Intron | NP_001139375.1 | ||||
NM_001178063.2 | Intron | NP_001171534.1 | ||||
NM_001282457.1 | Intron | NP_001269386.1 | ||||
NM_001282458.1 | Intron | NP_001269387.1 | ||||
NM_001282459.1 | Intron | NP_001269388.1 |
EHMT2 - euchromatic histone lysine methyltransferase 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZBTB12 - zinc finger and BTB domain containing 12 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_181842.2 | Intron | NP_862825.1 | ||||
XM_011514383.2 | Intron | XP_011512685.2 |