Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CACAACACTCTTCATGTTAAAAGCA[C/T]AGGATTCTAAGGCATTCTTTGCAGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 140550 MIM: 140559 MIM: 607282 | ||||||||||||||||||||
Literature Links: |
HSPA1A PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
HSPA1A - heat shock protein family A (Hsp70) member 1A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HSPA1L - heat shock protein family A (Hsp70) member 1 like | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_005527.3 | 1823 | Missense Mutation | NP_005518.3 |
LSM2 - LSM2 homolog, U6 small nuclear RNA and mRNA degradation associated | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |