Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCCTCTGCAGAGGCGGTGCCCTGCT[A/G]ACTTCGACCAGCGGCCCTGGTTTCC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 611605 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ERLIN2 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ERLIN2 - ER lipid raft associated 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001003790.3 | 236 | Silent Mutation | CTA,CTG | L,L 41 | NP_001003790.1 | |
NM_001003791.2 | 236 | Silent Mutation | CTA,CTG | L,L 41 | NP_001003791.1 | |
NM_007175.6 | 236 | Silent Mutation | CTA,CTG | L,L 41 | NP_009106.1 | |
XM_005273392.2 | 236 | Silent Mutation | CTA,CTG | L,L 41 | XP_005273449.1 | |
XM_006716280.2 | 236 | UTR 5 | XP_006716343.1 | |||
XM_017013000.1 | 236 | Silent Mutation | CTA,CTG | L,L 41 | XP_016868489.1 |
LOC101929622 - uncharacterized LOC101929622 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC102723701 - uncharacterized LOC102723701 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC728024 - chromosome X open reading frame 56 pseudogene | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |