Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGCCACTCACCTTGAAGGGCTTCAT[A/G]GAGTTCTGGATGGTGGGGACCATCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604900 MIM: 140580 | ||||||||||||||||||||
Literature Links: |
DGAT1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
DGAT1 - diacylglycerol O-acyltransferase 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_012079.5 | 925 | Silent Mutation | TCC,TCT | S,S 307 | NP_036211.2 | |
XM_011517356.2 | 925 | Silent Mutation | TCC,TCT | S,S 250 | XP_011515658.1 |
HSF1 - heat shock transcription factor 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR6848 - microRNA 6848 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |