Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCTTCAGGAAGTTTTGATCACCCGT[G/T]AGGTAATAGTCCCGATAAACCTGCA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 606443 MIM: 609471 MIM: 186745 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CREB3 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CREB3 - cAMP responsive element binding protein 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
GBA2 - glucosylceramidase beta 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_020944.2 | 2426 | Silent Mutation | CTA,CTC | L,L 634 | NP_065995.1 | |
XM_005251526.4 | 2426 | Intron | XP_005251583.1 | |||
XM_006716809.3 | 2426 | Silent Mutation | CTA,CTC | L,L 640 | XP_006716872.1 | |
XM_011517973.2 | 2426 | Silent Mutation | CTA,CTC | L,L 634 | XP_011516275.1 | |
XM_017014937.1 | 2426 | Intron | XP_016870426.1 | |||
XM_017014938.1 | 2426 | Silent Mutation | CTA,CTC | L,L 640 | XP_016870427.1 | |
XM_017014939.1 | 2426 | Intron | XP_016870428.1 | |||
XM_017014940.1 | 2426 | Silent Mutation | CTA,CTC | L,L 561 | XP_016870429.1 | |
XM_017014941.1 | 2426 | Silent Mutation | CTA,CTC | L,L 561 | XP_016870430.1 | |
XM_017014942.1 | 2426 | Silent Mutation | CTA,CTC | L,L 489 | XP_016870431.1 | |
XM_017014943.1 | 2426 | Silent Mutation | CTA,CTC | L,L 483 | XP_016870432.1 | |
XM_017014944.1 | 2426 | Silent Mutation | CTA,CTC | L,L 455 | XP_016870433.1 | |
XM_017014945.1 | 2426 | Silent Mutation | CTA,CTC | L,L 449 | XP_016870434.1 | |
XM_017014946.1 | 2426 | Silent Mutation | CTA,CTC | L,L 347 | XP_016870435.1 |
MIR6853 - microRNA 6853 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TLN1 - talin 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |