Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ATGGCTGCCTGCGAGGGCAGGAGAA[C/G]CGGAGCTCTCGGTTCCTCTCAGTCG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604346 | ||||||||||||||||||||
Literature Links: |
MAN1B1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MAN1B1 - mannosidase alpha class 1B member 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_016219.4 | 99 | Missense Mutation | ACC,AGC | T,S 9 | NP_057303.2 | |
XM_006716945.3 | 99 | Missense Mutation | ACC,AGC | T,S 9 | XP_006717008.1 | |
XM_017014239.1 | 99 | Intron | XP_016869728.1 |
MAN1B1-AS1 - MAN1B1 antisense RNA 1 (head to head) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
UAP1L1 - UDP-N-acetylglucosamine pyrophosphorylase 1 like 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |