Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCTCCTCCTCCTCTCTCACCTCAGT[A/G]TCTCCTTCTCCTAGGCCACAGGCCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 606443 MIM: 609471 MIM: 186745 | ||||||||||||||||||||
Literature Links: |
CREB3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CREB3 - cAMP responsive element binding protein 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
GBA2 - glucosylceramidase beta 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_020944.2 | 2810 | Silent Mutation | GAC,GAT | D,D 769 | NP_065995.1 | |
XM_005251526.4 | 2810 | Silent Mutation | GAC,GAT | D,D 753 | XP_005251583.1 | |
XM_006716809.3 | 2810 | Silent Mutation | GAC,GAT | D,D 775 | XP_006716872.1 | |
XM_011517973.2 | 2810 | Silent Mutation | GAC,GAT | D,D 769 | XP_011516275.1 | |
XM_017014937.1 | 2810 | Silent Mutation | GAC,GAT | D,D 747 | XP_016870426.1 | |
XM_017014938.1 | 2810 | Silent Mutation | GAC,GAT | D,D 775 | XP_016870427.1 | |
XM_017014939.1 | 2810 | Silent Mutation | GAC,GAT | D,D 747 | XP_016870428.1 | |
XM_017014940.1 | 2810 | Silent Mutation | GAC,GAT | D,D 696 | XP_016870429.1 | |
XM_017014941.1 | 2810 | Silent Mutation | GAC,GAT | D,D 696 | XP_016870430.1 | |
XM_017014942.1 | 2810 | Silent Mutation | GAC,GAT | D,D 624 | XP_016870431.1 | |
XM_017014943.1 | 2810 | Silent Mutation | GAC,GAT | D,D 618 | XP_016870432.1 | |
XM_017014944.1 | 2810 | Silent Mutation | GAC,GAT | D,D 590 | XP_016870433.1 | |
XM_017014945.1 | 2810 | Silent Mutation | GAC,GAT | D,D 584 | XP_016870434.1 | |
XM_017014946.1 | 2810 | Silent Mutation | GAC,GAT | D,D 482 | XP_016870435.1 |
MIR6853 - microRNA 6853 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TLN1 - talin 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |