Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCAGCAGACGGCGGCGTGGTACCAG[A/G]TGCCCATCCATGTATCTCTGAGCTC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 300110 MIM: 313475 | ||||||||||||||||||||
Literature Links: |
CACNA1F PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CACNA1F - calcium voltage-gated channel subunit alpha1 F | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001256789.2 | 2587 | Silent Mutation | CAC,CAT | H,H 1773 | NP_001243718.1 | |
NM_001256790.2 | 2587 | Silent Mutation | CAC,CAT | H,H 1719 | NP_001243719.1 | |
NM_005183.3 | 2587 | Silent Mutation | CAC,CAT | H,H 1784 | NP_005174.2 | |
XM_011543983.2 | 2587 | Silent Mutation | CAC,CAT | H,H 1712 | XP_011542285.1 | |
XM_017029836.1 | 2587 | Silent Mutation | CAC,CAT | H,H 834 | XP_016885325.1 |
SYP - synaptophysin | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SYP-AS1 - SYP antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |