Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCCACCCTGCGGGAGCTGAAGCTCA[A/G]TGCCAGCCTCCCTGCTCTGCTGCTC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 300197 MIM: 300104 | ||||||||||||||||||||
Literature Links: |
ATP6AP1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ATP6AP1 - ATPase H+ transporting accessory protein 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001183.5 | 900 | Missense Mutation | AAT,AGT | N,S 170 | NP_001174.2 | |
XM_011531179.1 | 900 | UTR 5 | XP_011529481.1 |
CH17-340M24.3 - uncharacterized protein BC009467 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
GDI1 - GDP dissociation inhibitor 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |