Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTGTGGCCACATGGTGTCAGATGAA[A/T]ATGAGCAGCTGTCCTCTGAAGGTAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 300081 MIM: 312173 | ||||||||||||||||||||
Literature Links: |
DNASE1L1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
DNASE1L1 - deoxyribonuclease I-like 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC107987332 - uncharacterized LOC107987332 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RPL10 - ribosomal protein L10 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001256577.2 | 522 | Missense Mutation | AAT,TAT | N,Y 57 | NP_001243506.2 | |
NM_001256580.2 | 522 | Intron | NP_001243509.2 | |||
NM_001303624.1 | 522 | Missense Mutation | AAT,TAT | N,Y 57 | NP_001290553.1 | |
NM_001303625.1 | 522 | Missense Mutation | AAT,TAT | N,Y 57 | NP_001290554.1 | |
NM_001303626.1 | 522 | Missense Mutation | AAT,TAT | N,Y 57 | NP_001290555.1 | |
NM_006013.4 | 522 | Missense Mutation | AAT,TAT | N,Y 57 | NP_006004.3 |
SNORA70 - small nucleolar RNA, H/ACA box 70 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |