Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCGAGATCTCAGCCCAGTAGCGCCC[T/A]GAGTGACAATCGCACATGACACTAT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 606999 MIM: 601978 | ||||||||||||||||||||
Literature Links: |
ARID3C PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ARID3C - AT-rich interaction domain 3C | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
GALT - galactose-1-phosphate uridylyltransferase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SIGMAR1 - sigma non-opioid intracellular receptor 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001282205.1 | 503 | Intron | NP_001269134.1 | |||
NM_001282206.1 | 503 | Intron | NP_001269135.1 | |||
NM_001282207.1 | 503 | Intron | NP_001269136.1 | |||
NM_001282208.1 | 503 | Missense Mutation | CAG,CTG | Q,L 125 | NP_001269137.1 | |
NM_001282209.1 | 503 | Intron | NP_001269138.1 | |||
NM_005866.3 | 503 | Intron | NP_005857.1 | |||
NM_147157.2 | 503 | Intron | NP_671513.1 |