Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCACAGGGGTGACCGTGCCTGGGCT[C/T]GGGGCTGTGGGGTCTGGAGGCAGGG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 609931 MIM: 609930 MIM: 601734 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
LOC107987175 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
LOC107987175 - uncharacterized LOC107987175 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MYL6 - myosin light chain 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MYL6B - myosin light chain 6B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SMARCC2 - SWI/SNF related, matrix associated, actin dependent regulator of chromatin subfamily c member 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
XM_005269101.1 | 3646 | Silent Mutation | CCA,CCG | P,P 1233 | XP_005269158.1 | |
XM_005269102.1 | 3646 | Silent Mutation | CCA,CCG | P,P 1232 | XP_005269159.1 | |
XM_005269103.1 | 3646 | Silent Mutation | CCA,CCG | P,P 1201 | XP_005269160.1 | |
XM_005269104.1 | 3646 | Silent Mutation | CCA,CCG | P,P 1139 | XP_005269161.1 | |
XM_011538693.2 | 3646 | Silent Mutation | CCA,CCG | P,P 982 | XP_011536995.1 | |
XM_017019884.1 | 3646 | Silent Mutation | CCA,CCG | P,P 1117 | XP_016875373.1 | |
XM_017019885.1 | 3646 | Silent Mutation | CCA,CCG | P,P 1109 | XP_016875374.1 | |
XM_017019886.1 | 3646 | Silent Mutation | CCA,CCG | P,P 1087 | XP_016875375.1 | |
XM_017019887.1 | 3646 | Silent Mutation | CCA,CCG | P,P 951 | XP_016875376.1 |