Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTTCCAGGACCGGGGATCCGACCCT[G/T]AGGAGGCCGCAGCTGCAGGCTGGTA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 107272 MIM: 157660 MIM: 604964 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ARHGEF39 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ARHGEF39 - Rho guanine nucleotide exchange factor 39 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CCDC107 - coiled-coil domain containing 107 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CD72 - CD72 molecule | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC101926948 - uncharacterized LOC101926948 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RMRP - RNA component of mitochondrial RNA processing endoribonuclease | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SIT1 - signaling threshold regulating transmembrane adaptor 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_014450.2 | 503 | Missense Mutation | AAG,CAG | K,Q 136 | NP_055265.1 |