Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGAGTCCTCACCAGGGACGGAGTAC[A/C]CCGCCTCCACAGGCAGCAGGAAAGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607931 MIM: 608937 MIM: 602389 | ||||||||||||||||||||
Literature Links: |
ATXN2L PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ATXN2L - ataxin 2 like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR4721 - microRNA 4721 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SH2B1 - SH2B adaptor protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TUFM - Tu translation elongation factor, mitochondrial | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_003321.4 | 1199 | Missense Mutation | GGG,GTG | G,V 268 | NP_003312.3 | |
XM_011545928.2 | 1199 | Missense Mutation | GGG,GTG | G,V 268 | XP_011544230.1 | |
XM_017023619.1 | 1199 | Missense Mutation | GGG,GTG | G,V 268 | XP_016879108.1 |