Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACCCTGGCTCCAGCTTCACTGGTCC[A/G]GGGGACGCCTCAGCCTGGGGCAGCT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 118970 MIM: 612861 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ARL10 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ARL10 - ADP ribosylation factor like GTPase 10 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001317948.1 | 965 | Intron | NP_001304877.1 | |||
NM_173664.5 | 965 | Intron | NP_775935.1 | |||
XM_011534529.2 | 965 | Intron | XP_011532831.1 | |||
XM_011534530.2 | 965 | Intron | XP_011532832.1 | |||
XM_011534531.2 | 965 | Intron | XP_011532833.1 | |||
XM_017009372.1 | 965 | Intron | XP_016864861.1 |
CLTB - clathrin light chain B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HIGD2A - HIG1 hypoxia inducible domain family member 2A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NOP16 - NOP16 nucleolar protein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001256539.3 | 965 | Silent Mutation | CCC,CCT | P,P 163 | NP_001243468.2 | |
NM_001256540.3 | 965 | Silent Mutation | CCC,CCT | P,P 162 | NP_001243469.2 | |
NM_001291305.2 | 965 | Silent Mutation | CCC,CCT | P,P 149 | NP_001278234.1 | |
NM_001291307.2 | 965 | UTR 3 | NP_001278236.1 | |||
NM_001291308.2 | 965 | UTR 3 | NP_001278237.1 | |||
NM_001317975.1 | 965 | UTR 3 | NP_001304904.1 | |||
NM_016391.7 | 965 | UTR 3 | NP_057475.2 | |||
XM_011534567.1 | 965 | UTR 3 | XP_011532869.1 |