Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGAACCATGTGCCCCTCACCTCATG[C/T]ACCAGTGGTGCCCCAGACAGGCCCT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 610561 MIM: 608547 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
PRSS53 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
PRSS53 - protease, serine 53 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001039503.2 | 2816 | Silent Mutation | GTA,GTG | V,V 483 | NP_001034592.1 | |
XM_011545816.1 | 2816 | Intron | XP_011544118.1 | |||
XM_011545817.1 | 2816 | Silent Mutation | GTA,GTG | V,V 530 | XP_011544119.1 | |
XM_011545818.2 | 2816 | Silent Mutation | GTA,GTG | V,V 530 | XP_011544120.1 | |
XM_011545819.1 | 2816 | Intron | XP_011544121.1 | |||
XM_011545820.1 | 2816 | Silent Mutation | GTA,GTG | V,V 483 | XP_011544122.1 |
VKORC1 - vitamin K epoxide reductase complex subunit 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZNF646 - zinc finger protein 646 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_014699.3 | 2816 | Intron | NP_055514.3 | |||
XM_005255710.3 | 2816 | Intron | XP_005255767.1 | |||
XM_005255711.3 | 2816 | Intron | XP_005255768.1 | |||
XM_005255712.3 | 2816 | Intron | XP_005255769.1 | |||
XM_011545990.2 | 2816 | Intron | XP_011544292.1 |
ZNF668 - zinc finger protein 668 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |