Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTGGCCAATAACAAGAAGGAGATTG[C/T]GGCCTTCCTCAAGCGCACGCTCAAC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||||||||||||||||||||
Literature Links: |
CFAP157 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CFAP157 - cilia and flagella associated protein 157 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001012502.2 | 294 | Missense Mutation | GCG,GTG | A,V 84 | NP_001012520.2 | |
XM_006717064.3 | 294 | Missense Mutation | GCG,GTG | A,V 179 | XP_006717127.2 | |
XM_011518559.2 | 294 | Missense Mutation | GCG,GTG | A,V 179 | XP_011516861.2 | |
XM_017014629.1 | 294 | Missense Mutation | GCG,GTG | A,V 179 | XP_016870118.1 | |
XM_017014630.1 | 294 | UTR 5 | XP_016870119.1 |
PTRH1 - peptidyl-tRNA hydrolase 1 homolog | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001002913.1 | 294 | Intron | NP_001002913.1 | |||
XM_006716955.3 | 294 | Intron | XP_006717018.1 | |||
XM_017014276.1 | 294 | Intron | XP_016869765.1 | |||
XM_017014277.1 | 294 | Intron | XP_016869766.1 | |||
XM_017014278.1 | 294 | Intron | XP_016869767.1 |
TTC16 - tetratricopeptide repeat domain 16 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |