Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGGCATTGTCCGGCCTCTGGCCCCC[C/T]GGGACAGCTCGTTTGAGCCCCAGCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 616525 | ||||||||||||||||||||
Literature Links: |
C17orf89 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C17orf89 - chromosome 17 open reading frame 89 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLC38A10 - solute carrier family 38 member 10 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001037984.2 | 2893 | Silent Mutation | NP_001033073.1 | |||
NM_138570.3 | 2893 | Intron | NP_612637.1 | |||
XM_005257019.1 | 2893 | Silent Mutation | XP_005257076.1 | |||
XM_011524288.1 | 2893 | Silent Mutation | XP_011522590.1 | |||
XM_011524289.1 | 2893 | Silent Mutation | XP_011522591.1 | |||
XM_011524290.1 | 2893 | Silent Mutation | XP_011522592.1 |
TEPSIN - TEPSIN, adaptor related protein complex 4 accessory protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |