Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGCCGCCAGGGCGCGCAGCGTGTCG[C/T]CGGGTGGGGGCGGCCGGCCCCGCAG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 600240 MIM: 602346 MIM: 605785 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CCR10 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CCR10 - C-C motif chemokine receptor 10 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CNTNAP1 - contactin associated protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PLEKHH3 - pleckstrin homology, MyTH4 and FERM domain containing H3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_024927.4 | 1898 | Missense Mutation | GAC,GGC | D,G 532 | NP_079203.3 | |
XM_017025113.1 | 1898 | Missense Mutation | GAC,GGC | D,G 621 | XP_016880602.1 | |
XM_017025114.1 | 1898 | Missense Mutation | GAC,GGC | D,G 618 | XP_016880603.1 | |
XM_017025115.1 | 1898 | Missense Mutation | GAC,GGC | D,G 577 | XP_016880604.1 | |
XM_017025116.1 | 1898 | Missense Mutation | GAC,GGC | D,G 576 | XP_016880605.1 | |
XM_017025117.1 | 1898 | Missense Mutation | GAC,GGC | D,G 561 | XP_016880606.1 | |
XM_017025118.1 | 1898 | Missense Mutation | GAC,GGC | D,G 529 | XP_016880607.1 |
TUBG2 - tubulin gamma 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |