Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGACGGCGGGGTCCTGGGGCTGAGC[G/T]TGGAGCAGGTGGGCACGCTGTTTGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 611893 MIM: 190700 | ||||||||||||||||||||
Literature Links: |
MIR4530 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MIR4530 - microRNA 4530 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PLEKHG2 - pleckstrin homology and RhoGEF domain containing G2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_022835.2 | 1280 | Missense Mutation | GTG,TTG | V,L 142 | NP_073746.2 | |
XM_005259163.2 | 1280 | Missense Mutation | GTG,TTG | V,L 142 | XP_005259220.1 | |
XM_006723334.2 | 1280 | Missense Mutation | GTG,TTG | V,L 83 | XP_006723397.1 | |
XM_011527232.2 | 1280 | Missense Mutation | GTG,TTG | V,L 143 | XP_011525534.1 | |
XM_017027150.1 | 1280 | Missense Mutation | GTG,TTG | V,L 143 | XP_016882639.1 | |
XM_017027151.1 | 1280 | Missense Mutation | GTG,TTG | V,L 143 | XP_016882640.1 |
ZFP36 - ZFP36 ring finger protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |